This topic contains 0 replies, has 1 voice, and was last updated by vvjpapa 5 years, 2 months ago.
Viewing 1 post (of 1 total)
Viewing 1 post (of 1 total)
You must be logged in to reply to this topic.
南卡中文学校 Chinese School of South Carolina › Forums › Eduma Forum › Pqe vector manual
This topic contains 0 replies, has 1 voice, and was last updated by vvjpapa 5 years, 2 months ago.
.
.
PQE VECTOR MANUAL >> DOWNLOAD NOW
PQE VECTOR MANUAL >> READ ONLINE
.
.
.
.
.
.
.
.
.
.
pET System Manual TB055 8th Edition 02/99 Novagen 1 United States & Canada Orders: 800 526-7319 Technical Service: 800 207-0144 Table of Contents I. About the System 3 A. Description 3 B. Licensing and Use Agreement 3 C. System Components 3 D. The pET Vectors 4 Vector Characteristics and Cloning Strategy 4 Ligation-Independent Cloning (LIC) of
Selectable marker. In the absence of selective pressure plasmids are lost from the host. Especially in the case of very high copy number plasmids and when plasmid-borne genes are toxic to the host or otherwise significantly reduce its growth rate.
Member States. EMBL is an intergovernmental organisation, consisting of more than 20 member states, associate and prospect members. About EMBL’s member states ›
Use pQE-80L vector for fast, easy, and consistent DNA/RNA Purification, Antibody/Protein Purification, Cell Isolation.
pQE-40 Vector Positions of elements in bases Vector size 4031 Start of numbering at XhoI (CTCGAG) 1-6 T5 promoter/lac operator element 7-87 T5 transcription start 61 6xHis-tag coding sequence 127-144 Dehydrofolate reductase coding sequence 157-714 Multiple cloning site 721-762 Lambda t 0 transcriptional termination region 778-872
pQE-9 3.4 kb A m p ic i l n 6xHis Eco RI/RBS 6xHis ATGAGAGGATCG RGS·His epitope pQE-9 Bam HI t 0 GGATCCGTCGACCTGCAGCCAAGCTT Hind III AATTAGCTGAG Sal I Pst I pQE-9 Vector Positions of elements in bases Vector size (bp) 3439 Start of numbering at XhoI (CTCGAG) 1-6 T5 promoter/lac operator element 7-87 T5 transcription start 61 6xHis-tag
The CloneJET PCR Cloning Kit contains a novel, ready-to-use positive selection cloning vector pJET1.2/blunt. The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site. As a result, only bacterial cells with recombinant plasmids are able to form colonies.
USER GUIDE 1 Vector Multirotor/Fixed Wing Flight Controller + OSD User Guide March, 2018 Version 3.6 Software Version
You must be logged in to reply to this topic.